• Modifies a a string or list (sequence) by putting an insertion into it.
• The insertion point may be specified by AT insertion-point or FROM insertion-point.
  Either way, insertion-point represents the coordinate after which the insertion will appear.
• If AT insertion-point is used to specify the insertion point, then:
        DELETE length may be used to specify how much of sequence is to be replaced by insertion.
        If DELETE is not specified, then a clean insertion (without deletion) is made.
• If FROM insertion-point is used to specify the insertion-point, then:
        TO end-point specifies the end coordinate of sequence to be replaced by insertion.
        If TO is not specified, then insertion is inserted into sequence at the insertion-point,
        replacing the remainder of sequence.
• The insertion into a list may be a list or any value.
• The insertion into a string must be a string or a character.

Example:
  (ASSIGN favorite-genes (ALL-ORTHOLOGS-OF all4312))
  ::
  (INSERT (GENE-NAMED all4311) INTO favorite-genes AT 3)
  ::

Example:
  (ASSIGN short-gene "ATGGAATTCCTGCAATTAA")
  :: "ATGGAATTCCTGCAATTAA"
  (INSERT "TTTT" INTO short-gene FROM 3 TO 4)
  :: "ATGTTTTAATTCCTGCAATTAA"